12-12-2022
Mathematics

contestada

what is 5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x5x1002333x55

Respuesta :

Otras preguntas

An account receivable that has been written off against the allowance account a. may be paid in cash and recorded as a receipt on account. b. may be collected

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

Emily, who lives in Indiana, volunteered to travel to Louisiana in March to work on a home-building project for Habitat for Humanity (a qualified charitable org

0) How many yards is 24 feet?

What is the answer for 0.516/6

A new car worth 30,000 is depreciating in value by $3,000 per year. After how many years will the car’s value be $6,000?

Simplify the expression -6(10+9v)

The Capitals Company has provided you the following information pertaining to the year ending December 31, 2018: January 1, 2018 December 31, 2018 Equipment $ 5

Which Of the following types of diseases, which one would give you maximum certainty of the genotypes for all affected individuals based on their phenotypes? A.

The effect of Uncle Tom's Cabin on the nation was toa. spread the message of abolitionism to an enormous new audience. b. reveal the ugly extent of the vicious