SheenaAlleshouse SheenaAlleshouse

12-08-2015
Mathematics

contestada

Consider the function f(x) = x2 − 2x + 6. Find the value of f(x) when x = 3 and select the correct answer below. a) 1 b) 3 c) 6 d) 9

Respuesta :

12-08-2015

[tex]f(x)=x^2-2x+6 \\ \Downarrow \\ f(3)=3^2 -2 \times 3+6=9-6+6=9[/tex]

The answer is D. 9.

Answer Link

Otras preguntas

The Grimms’ fairy tales address the experiences of people who are living in difficult situations. For example, there is the story of Rapunzel. There is also the

A rectangle has an area of 35 square meters what could the length and width be

It cost Erica $9.75 for the ingredients to make 30 cupcakes. She sold them for $1.00 each. What was Erica’s total profit? STEP BY STEP PLZZ PLEASE PLZZZZZ

PLZ HELP (100 poiNts) Fill in the blank. Remember to spell correctly. Pygmies do not have leaders or a ______.

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

What is the coordinate of the midpoint of (2, 1) and (18, 7)?

If you are using a calculator to find the measure of an angle in degrees, what type of measure might make you question whether your calculator is in radian mode

. Où est-ce que tu habitais?

Select all the correct answers. What were the two main purposes of the Declaration of Independence? formally announce the independence of the American colonies

Element X is a solid at room temperature.It needs one electron per atom to gain the electronic structure of a noble gas.It is the least reactive element in its